| Description: pRNA-U6.1/Neo is a Genscript siRNA expression vector. It is designed for mammalian transfection. It carries a neomycin resistance gene that can be used for establishing stable cell line. It uses a U6 promoter for siRNA expression.
|
 |
| Download Protocol:tm0169 |
Forward Sequencing Primer:
DA0011:pRNA-U6 Forward （TACGATACAAGGCTGTTAGAGAG） |
Reverse Sequencing Primer:
DA0012:pRNA Reverse （TAGAAGGCACAGTCGAGG） |
Detailed Map:
|
| Polylinker:78-101 |
| U6 Promoter:4829-77 |
| SV40:850-1195 |
| Neomycin:1236-2030 |
| pUC ori:2744-3384 |
| Ampicillin:3532-4392 |
Publications used this GenScript Product:
|
- Shiou-Hwa Jee, Chia-Yu Chu, Hien-Ching Chiu, Yi-Ling Huang, Wei-Ling, Tsai, Yi-Hua Liao, and Min-Liang Kuo. Interleukin-6 Induced Basic Fibroblast Growth Factor-Dependent Angiogenesis in Basal Cell Carcinoma Cell Line via JAK/STAT3 and PI3-Kinase/AktPathways. J. Invest. Dermatol. Dec 2004; 123 （6） :1169-1175
|
- Mi-Jung Lee, Jee-Youn Kim, Kyoungho Suk, and Jae-Hoon Park. Identification of the Hypoxia-Inducible Factor 1-Responsive HGTD-P Gene as a Mediator in the Mitochondrial Apoptotic Pathway. Mol. Cell. Biol. May 2004; 24 （9） :3918-3927
|
- Jesang Ko, Sung-Wuk Jang, Yoon Suk Kim, In Sik Kim, Ho Joong Sung, Hong-Hee Kim, Joong-Yeol Park, Young Han Lee, Jiyoung Kim, and Doe Sun Na. Human LZIP binds to CCR1 and differentially affects the chemotactic activities of CCR1-dependent chemokines. FASEB. J. May 2004; 18 （7） :890-892
|
- Katrin Mani, Fang Cheng, Birgitta Havsmark, Samuel David, and Lars-Ake Fransson. Involvement of GPI-linked ceruloplasmin in the Cu/Zn-NO-dependent degradation of glypican-1 heparan sulfate in Rat C6 glioma cells. J. Biol. Chem. Mar 2004; 279 （13） :12918-12923
|
- Marilee J. WICK, Stacy BLAINE, Vicki VAN PUTTEN, Milene SAAVEDRA and Raphael A. NEMENOFF. Lung Krüppel-like factor （LKLF） is a transcriptional activator of the cytosolic phospholipase A2 α promoter. Biochemical. J. Apr 2005; 387 （1） :239-246
|
- Yau TO, Chan CY, Chan KL, Lee MF, Wong CM, Fan ST, Ng IO. HDPR1, a novel inhibitor of the WNT/b-catenin signaling, is frequently downregulated in hepatocellular carcinoma: involvement of methylationmediated gene silencing. Oncogene. Feb 2005; 24 （9） :1607-1614
|
- Punita Dhawan, Amar B. Singh, Natasha G. Deane, YiRan No, Sheng-Ru Shiou, Carl Schmidt, John Neff, M. Kay Washington, and R. Daniel Beauchamp. Claudin-1 regulates cellular transformation and metastatic behavior in colon cancer. J. Clin. Invest. Jul 2005; 115 （7） :1765-1776
|
- Masahiro Sugano, Keiko Tsuchida, Tomoji Hata, and Naoki Makino. RNA interference targeting SHP-1 attenuates myocardial infarction in rats. FASEB. J. Dec 2005; 19 （14） :2054-2056
|
- Devoogdt N, Revets H, Kindt A, Liu YQ, De Baetselier P, Ghassabeh GH. The Tumor-Promoting Effect of TNF-{alpha} Involves the Induction of Secretory Leukocyte Protease Inhibitor. J. Immunol. Dec 2006; 177 （11） :8046-8052
|
- Xia S, Forman LW, Faller DV. PKCdelta is required for survival of cells expressing activated p21Ras. J. Biol. Chem. Mar 2007;
|
- Kondo S, Shukunami C, Morioka Y, Matsumoto N, Takahashi R, Oh J, Atsumi T, Umezawa A, Kudo A, Kitayama H, Hiraki Y, Noda M. Dual effects of the membrane-anchored MMP regulator RECK on chondrogenic differentiation of ATDC5 cells. J. Cell Sci. Mar 2007; 120 （5） :849-857
|
- Lay JD, Hong CC, Huang JS, Yang YY, Pao CY, Liu CH, Lai YP, Lai GM, Cheng AL, Su IJ, Chuang SE. Sulfasalazine Suppresses Drug Resistance and Invasiveness of Lung Adenocarcinoma Cells Expressing AXL. Cancer Res. Apr 2007; 67 （8） :3878-3887
|
- Qian Y, Zheng Y, Weber D, Tiffany-Castiglioni E. A 78kD Glucose-Regulated Protein Is Involved in Decrease of Interleukin-6 Secretion by Lead Treatment from Astrocytes. Am. J. Physiol. Cell Physiol. Jun 2007;
|
- Yongchang Qian, Ying Zheng, Deanna Weber, and Evelyn Tiffany-Castiglioni A 78-kDa glucose-regulated protein is involved in the decrease of interleukin-6 secretion by lead treatment from astrocytes Am.J. Physiol. Cell Physiol. Sep 2007; 293 （3） :C897 - C905
|
- Konstantin Levay and Vladlen Z. Slepak Tescalcin is an essential factor in megakaryocytic differentiation associated with Ets family gene expression J. Clin. Invest. Sep 2007; 117 :2672 - 2683
|
會(huì)員1.png)
